View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3319_high_20 (Length: 257)
Name: NF3319_high_20
Description: NF3319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3319_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 1769608 - 1769838
Alignment:
| Q |
11 |
aagaaaatcaggaaatggaccagaaattttgaggaggtttatcaagtagattccatcaaggaatttgagttttgagagtgatggtgagattgtacctgac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769608 |
aagaaaatcaggaaatggaccagaaattttgaggaggtttatcaagtagattccatcaaggaatttgagttttgagagtgatggtgagattgtacctgac |
1769707 |
T |
 |
| Q |
111 |
aagaagcttttaggattttcagtgtcaccggttaaagataaacttgtcacccgtttgtcgaccagacaccctacacctacccatgtgcaacaatttgtac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769708 |
aagaagcttttaggattttcagtgtcaccggttaaagataaacttgtcacccgtttgttgtccagacaccctacacctacccatgtgcaacaatttgtac |
1769807 |
T |
 |
| Q |
211 |
ccggtatccatgacttgagcatggatgtcgg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1769808 |
ccggtatccatgacttgagcatggatgtcgg |
1769838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University