View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3319_high_25 (Length: 249)
Name: NF3319_high_25
Description: NF3319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3319_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 232
Target Start/End: Complemental strand, 47424199 - 47423987
Alignment:
| Q |
20 |
tatcattttatactctatatctcttacatcctttcatgagttattttataactttttatttcgaggactgctatatgtagcgagaactttatcccgaaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47424199 |
tatcattttatactctatatctcttacatcctttcatgagttattttataactttttatttcgaggactgctatatgtagcgagaactttatcccgaaat |
47424100 |
T |
|
| Q |
120 |
gcccttatacttacttgatcttgcctatgataatttctaaactcacagcacaatatttagtgcttaacttctcttatatctcatacaacagaacaatttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47424099 |
gcccttatacttacttgatcttgcctatgataatttctaaactcacagcacaatatttagtgcttaacttctcttatatctcatacaacagaacaatttc |
47424000 |
T |
|
| Q |
220 |
atgcaccaacatt |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47423999 |
atgcaccaacatt |
47423987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 22369523 - 22369495
Alignment:
| Q |
1 |
caatttgggacggagggagtatcatttta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22369523 |
caatttgggacggagggagtatcatttta |
22369495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 8247155 - 8247127
Alignment:
| Q |
1 |
caatttgggacggagggagtatcatttta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8247155 |
caatttgggacggagggagtatcatttta |
8247127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University