View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3319_low_12 (Length: 339)
Name: NF3319_low_12
Description: NF3319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3319_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 9469743 - 9470060
Alignment:
| Q |
1 |
cctctttctctcacatcgaactccccaaaaccagacaccatgttcgtcttcactgcctcaccaaccaccctccaccgtctcagccaccaacatcaaaccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9469743 |
cctctttctctcacatcgaactccccaaaaccagacaccatgttcgtcttcactgcctcaccaaccaccctcc----tctcagccaccaacatcaaaccc |
9469838 |
T |
|
| Q |
101 |
ttcatcatcgtcaaactaacccttcgtcgtcatcatcaaatccttgaattttttggtattctgtttgtgttctatatggttgaagatgaattgatgttgt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9469839 |
ttcatcctcgtcaaactaacccttcgtcgtcatcatcaaatccttgaattttttggtattctgtttgtgttctatatggttgaagatgaattgatgttgt |
9469938 |
T |
|
| Q |
201 |
tcaaaactaaatcactaggcagattttatatgaaagtaagatctaataagattcattttattaaaaacatgttgctatttggaatattgacgcaatgcca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9469939 |
tcaaaactaaatcactaggcagattttatatgaaagtatgatctaataagattcattttattaaaaacatgttgctatttggaatattgacgcaatgcca |
9470038 |
T |
|
| Q |
301 |
acgtctgattgaactagttatt |
322 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9470039 |
acgtctgattgaactagttatt |
9470060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University