View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3319_low_15 (Length: 303)

Name: NF3319_low_15
Description: NF3319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3319_low_15
NF3319_low_15
[»] chr7 (1 HSPs)
chr7 (16-286)||(46103691-46103961)


Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 286
Target Start/End: Original strand, 46103691 - 46103961
Alignment:
16 attggataaggcaacccttgnnnnnnntatcgctggcagttctttcccaccataacaaacatactatgcgagccagaaattgaaatgaaaacattaaaa- 114  Q
    ||||||||||||||||||||       |||||||||||||||||||||||||||||| ||||||| ||| ||| |||||||||||||||||||||||||     
46103691 attggataaggcaacccttgaaaaaaatatcgctggcagttctttcccaccataacatacatact-tgcaagcgagaaattgaaatgaaaacattaaaaa 46103789  T
115 ttgcatgaatgaatttggtggtaatagtaatacaaaatcagtttcgttagtaaatcagcactcattcattcattcatcatggccatggccatggcctttc 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46103790 ttgcatgaatgaatttggtggtaatagtaatacaaaatcagtttcgttagtaaatcagcactcattcattcattcatcatggccatggccatggcctttc 46103889  T
215 aaacaacacactcttatctaaccacaacaaacttcatcttctcctctagtctcaaacgactcaccaaacctt 286  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
46103890 aaacaacacactcttatctaaccacaacaaacttcatcttctcttctagtctcaaacgactcaccaaacctt 46103961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University