View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3319_low_16 (Length: 298)
Name: NF3319_low_16
Description: NF3319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3319_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 285
Target Start/End: Complemental strand, 23939597 - 23939328
Alignment:
| Q |
18 |
aagaagggttttgttggttggtatagttgaggaaatatgtgatgagacatttcatgttgacagaagagagagagcacaacccgggaatggttgtaaagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23939597 |
aagaagggttttgttggttggtatagttgaggaaatatgtgatgagacatttcatgttgacagaagagagagagcacaacccgggaatggttgtaaagag |
23939498 |
T |
 |
| Q |
118 |
agtctttgcctttgttgggagtgtgctctcccttcttctgtcatcatcacatcactcacactatactttccatctttggctatttgtgagac--ttgcac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
23939497 |
agtctttgcctttgttgggagtgtgctctcccttcttctgtcatcatcacatcactcacactatactttccatctttggctatatatgagacatttgcac |
23939398 |
T |
 |
| Q |
216 |
gattatctcataccaatcaaggtaatctcacccttttctatacttcatattcattgtttctatctgtcct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23939397 |
gattatctcataccaatcaaggtaatctcacccttttttatacttcatattcattgtttctatctgtcct |
23939328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University