View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3319_low_25 (Length: 250)
Name: NF3319_low_25
Description: NF3319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3319_low_25 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 1769240 - 1769482
Alignment:
| Q |
8 |
agagatgaaattgaaagtggaatattcccggaaaatttgttgtgagaaagttcgagaataataaggttttttaaggaagtgaaaatatcaggtatgttac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769240 |
agagatgaaattgaaagtggaatattcccggaaaatttgttgtgagaaagttggagaataataaggttttttaaggaagtgaaaatatcaggtatgttac |
1769339 |
T |
 |
| Q |
108 |
cactaagttggtttccttggagactaaggtatgtgagatttgttaggtttttaagggatactggaatggttcctgtgagaaaattgttacctagttttaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769340 |
cactaagttggtttccttggagactaaggtatgtgagatttgttaggtttttaagggatactggaatggttcctgtgagaaaattgttacctagttttaa |
1769439 |
T |
 |
| Q |
208 |
ctgagttactttagtcaatgcagatattgaactaggaattggt |
250 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1769440 |
ctgagttaatttagtcaatgcagatattgaactaggaattggt |
1769482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University