View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3319_low_26 (Length: 250)
Name: NF3319_low_26
Description: NF3319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3319_low_26 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 135 - 250
Target Start/End: Original strand, 27713559 - 27713674
Alignment:
| Q |
135 |
gtaggagaaatatataaagaagtaaatgaattcttacaataactagtgccttgatttccttcgttgtcaataatggattattattgacatctttcaacga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27713559 |
gtaggagaaatatataaagaagtaaatgaagtcttacaataagtagtgccttgatttccttcgttgtcaataatggattattattgacatctttcaacga |
27713658 |
T |
 |
| Q |
235 |
gatcaaaacatctagc |
250 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27713659 |
gatcaaaacatctagc |
27713674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 161 - 250
Target Start/End: Complemental strand, 27698528 - 27698439
Alignment:
| Q |
161 |
tgaattcttacaataactagtgccttgatttccttcgttgtcaataatggattattattgacatctttcaacgagatcaaaacatctagc |
250 |
Q |
| |
|
|||| |||||| |||| | |||||||||| |||||||||||||||||||| ||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
27698528 |
tgaagtcttaccataatttgtgccttgatctccttcgttgtcaataatggtttattattggcatctttcagcgtgatcaaaacatctagc |
27698439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 166 - 250
Target Start/End: Complemental strand, 26409512 - 26409428
Alignment:
| Q |
166 |
tcttacaataactagtgccttgatttccttcgttgtcaataatggattattattgacatctttcaacgagatcaaaacatctagc |
250 |
Q |
| |
|
||||||||||| | ||||||||||||||||| ||||||||| ||||||||||| |||||||| | ||||||| |||||||||| |
|
|
| T |
26409512 |
tcttacaataagttgtgccttgatttccttctttgtcaataccggattattattaacatctttaagtgagatcagaacatctagc |
26409428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University