View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3320_high_2 (Length: 497)
Name: NF3320_high_2
Description: NF3320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3320_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 443; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 443; E-Value: 0
Query Start/End: Original strand, 15 - 484
Target Start/End: Complemental strand, 46069952 - 46069482
Alignment:
| Q |
15 |
cataggagactggatgactgtagggctattgctgcgagatttatgaatatgtatggctgctgtcagaatttagaagtgtctcaaattgctgctggtggtc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46069952 |
cataggagactggatgactgtagggctattgctgcgagatttatgaatatgtatggctgctgtcagaatttagaagtgtctcaaattgctgctggtggtc |
46069853 |
T |
|
| Q |
115 |
aaattttttggtgcagtccacttgttgaaaactcttggttctggtttttgtgatgctcgattgtgatggggcggtgtgcaacttggggtataatgttgcg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46069852 |
aaattttttggtgcagtccacttgttgaaaactcttggttctggtttttgtgatgctcgattgtgatgggacggtgtgcaacttggggtataatgttgcg |
46069753 |
T |
|
| Q |
215 |
gtcgagtgtattttgagaagctcg-attatctctttctacctggctttacaggcaatcttggttcttgctctgtcattgaggtagattgagaaaggtaat |
313 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46069752 |
gtcgagtgtattttgagaagctcggattatctctttctacctggctttacaggcaatcttggttcttgctctgtcattgaggtagattgagaaagttaat |
46069653 |
T |
|
| Q |
314 |
aacaagacatttttggtggtttcagactttgtgtcggttgttcaacttgtgaagatggggacgaggaatcaacatcctctttaaaagtttgtatgggaaa |
413 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46069652 |
aacaagaaatttttggtggtttcagactttgtgtcggttgttcaacttgtgaatatggggacgaggaatcaacatcctctttacaagtttgtatgggaaa |
46069553 |
T |
|
| Q |
414 |
gcttgtaggactccttgtttggaaatgagaaaaattcatcgaatccattaatttatggtaagatgattttg |
484 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46069552 |
gcttgtaggactccttgtttggaaatgagaaaaattcatcgaatccattaatttatggtaagatgattttg |
46069482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University