View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3320_high_31 (Length: 241)
Name: NF3320_high_31
Description: NF3320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3320_high_31 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 55002939 - 55003172
Alignment:
| Q |
17 |
agattgaatgtgtatcgggtgcctaacatgatgccaatgcatgtggtacatccaataatttctattatatcaaattattaccaatgtcaacttgtatttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55002939 |
agattgaatgtgtatcgggtgcctaacacgatgccaatgcatgtggtacatccaatcatttctattttatcaaattattaccaatgtcaacttgtatttt |
55003038 |
T |
|
| Q |
117 |
cttgctgatcgacttgatagatttctcaaatcatacgaattatagtt---------atttgattgtaaaacatcgtattttaaaagtgaaacatatcagg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55003039 |
cttgctgatcgacttgatagatttctcaaatcatacgaattatagttatttgattgatttgattgtaaaacatcgtattttaaaagtgaaacatatcagg |
55003138 |
T |
|
| Q |
208 |
ctgagcagaaaggaagaattggaatagtgatttc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
55003139 |
ctgagcagaaaggaagaattggaatagtgatttc |
55003172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University