View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3320_high_36 (Length: 235)
Name: NF3320_high_36
Description: NF3320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3320_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 218
Target Start/End: Original strand, 52830371 - 52830576
Alignment:
| Q |
14 |
gcagagatgatatgcacatatggtcatg-cttgcgatataaagcaaaagctgagtgtgccctagtatggtaatacatatctcttttccaggcttcagctg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52830371 |
gcagagatgatatgcacatatggtcatgtcttgcgatataaagcaaaagctgagtgtgccctagtatggtaatacatatctcttttccaggcttcagctg |
52830470 |
T |
|
| Q |
113 |
caacaaaaggattttttcagcctaatttaaagcaatgtttcaggcttgccaaacatagcctgacacagaacaaccctactcgtctaacactgcatggggt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52830471 |
caacaaaaggattttttcagcctaatttaaagcaatgtttcaggcttgccaaacatagcctgacacagaacaaccctactcgtctaacactgcatggggt |
52830570 |
T |
|
| Q |
213 |
gagttt |
218 |
Q |
| |
|
|||||| |
|
|
| T |
52830571 |
gagttt |
52830576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University