View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3320_high_37 (Length: 230)
Name: NF3320_high_37
Description: NF3320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3320_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 218
Target Start/End: Original strand, 45211888 - 45212096
Alignment:
| Q |
14 |
atcatttcttgcaacttttgagtaggagtattgtagagtgatatacatattgagctcggctatagattc----ttttaattttatttgagatgatgaata |
109 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
45211888 |
atcatttcttgcaactcttgagtaggagtattgtagagtgatatacatattgagctcggctatagattcattcttttaattttatttgaggtgatgaata |
45211987 |
T |
 |
| Q |
110 |
tatttgttaaggtgcttccgtggatgtaggcaagaggggccaattcacataaatctctgttttacatcaaagattcatgggtgtgaggctaacttcgatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45211988 |
tatttgttaaggtgcttccgtggatgtaggcaagaggtgccaattcacatcaatctctgttttacatcaaagattcatgggtgtgtggctaacttcgatg |
45212087 |
T |
 |
| Q |
210 |
gtctgtgct |
218 |
Q |
| |
|
|| |||||| |
|
|
| T |
45212088 |
gtgtgtgct |
45212096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 116
Target Start/End: Original strand, 15679873 - 15679903
Alignment:
| Q |
86 |
taattttatttgagatgatgaatatatttgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15679873 |
taattttatttgagatgatgaatatatttgt |
15679903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University