View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3320_high_4 (Length: 459)
Name: NF3320_high_4
Description: NF3320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3320_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 1e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 22 - 127
Target Start/End: Original strand, 29472985 - 29473090
Alignment:
| Q |
22 |
attgattactctttagggaaaacaaactaaaacaatgatgtgattctatttgttacaatgtttcttgttttttgttgattgtgtttattaaaggctaaag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||| |
|
|
| T |
29472985 |
attgattactctttagggaaaacaaactaaaacaatgatgtgattctatttgttacaatgtttcttcttttttgttgattgtgtttattaaaggttcaag |
29473084 |
T |
|
| Q |
122 |
tgcact |
127 |
Q |
| |
|
|||||| |
|
|
| T |
29473085 |
tgcact |
29473090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University