View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3320_low_38 (Length: 237)
Name: NF3320_low_38
Description: NF3320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3320_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 6 - 221
Target Start/End: Complemental strand, 31860908 - 31860692
Alignment:
| Q |
6 |
atgtcgaagaaaatctcacattgtttagaattaattgtaaagaaaggggagaccaaactatatatgagttatagtttttgcttgcaaaatgtactggttg |
105 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860908 |
atgttgaaaaaaatctcacattgtttagaattaattgtaaagaaaggggagaccaaactatatatgagttatagtttttgcttgcaaaatgtactggttg |
31860809 |
T |
|
| Q |
106 |
aaaacactcttgcattt-aaccnnnnnnnnnnnnnnccttgtcttatactcttgtcttagaatgttttaagatgtatttaatatttcctttggagggtgt |
204 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860808 |
aaaacactcttgcatttaaactttttttttttttttccttgtcttatactcttgtcttagaatgttttaagatgtatttaatatttcctttggagggtgt |
31860709 |
T |
|
| Q |
205 |
tgatgtactgggggttg |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31860708 |
tgatgtactgggggttg |
31860692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University