View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3321-Insertion-14 (Length: 119)
Name: NF3321-Insertion-14
Description: NF3321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3321-Insertion-14 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 6 - 119
Target Start/End: Complemental strand, 36402818 - 36402705
Alignment:
| Q |
6 |
caaagatatcagcttggcagaatgctaaagttgctaagattaataacaggttcaagagagatgatgctgtcatcaatggctgggagagtgaacaggttca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36402818 |
caaagatatcagcttggcagaatgctaaagttgctaagattaataacaggttcaagagagatgatgctgtcatcaatggctgggagagtgaacaggttca |
36402719 |
T |
|
| Q |
106 |
gaaagctacttcat |
119 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36402718 |
gaaagctacttcat |
36402705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 7e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 7e-19
Query Start/End: Original strand, 20 - 119
Target Start/End: Complemental strand, 21428914 - 21428815
Alignment:
| Q |
20 |
tggcagaatgctaaagttgctaagattaataacaggttcaagagagatgatgctgtcatcaatggctgggagagtgaacaggttcagaaagctacttcat |
119 |
Q |
| |
|
||||| || ||||| ||||||||| ||||||||||||| || || || |||||||| |||||||| ||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
21428914 |
tggcaaaacgctaaggttgctaaggttaataacaggtttaaaagggaagatgctgttatcaatggttgggagaatgagcaggttcagaaagctaattcat |
21428815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University