View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3321-Insertion-15 (Length: 270)
Name: NF3321-Insertion-15
Description: NF3321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3321-Insertion-15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 102 - 270
Target Start/End: Original strand, 1551743 - 1551914
Alignment:
| Q |
102 |
ttgtattgtaaaacaacaacaacaaaaaata---ctatgagttgcggataagttccaccaaaaggaagggaagaggtacaaaaagtatcagtcactaacc |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||| | |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
1551743 |
ttgtattgtaaaacaacaacaaaaaaaaaaaaaactatgagttgcggataagtttcaccaaaaggaagggaagaggtagaaaaagtatcattcactaacc |
1551842 |
T |
 |
| Q |
199 |
cttaagtaacgagcgtattattttgaagtctttattgcttgcttttcttcacttcttttttcccaaagtgca |
270 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1551843 |
cttaagtaacgagtgtattattttgaagtctttattgcttgtttttcttcacttcttttttcccaaagtgca |
1551914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University