View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3321-Insertion-17 (Length: 113)
Name: NF3321-Insertion-17
Description: NF3321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3321-Insertion-17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 9e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 9e-49
Query Start/End: Original strand, 7 - 112
Target Start/End: Original strand, 30552127 - 30552232
Alignment:
| Q |
7 |
actatctaggtgcatctttgttattattacttgcagtttagtccccgcaagaagagcaatcttcagtagcaaacaagaaagaaagtcacaaagaatatga |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30552127 |
actatcaaggtgcatctttgttattattacttgcagtttagtccccgcaagaagagcaatcttcaatagcaaacaagaaagaaagtcacaaagaatatga |
30552226 |
T |
 |
| Q |
107 |
agaaga |
112 |
Q |
| |
|
|||||| |
|
|
| T |
30552227 |
agaaga |
30552232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University