View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3321-Insertion-18 (Length: 76)
Name: NF3321-Insertion-18
Description: NF3321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3321-Insertion-18 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 8 - 76
Target Start/End: Complemental strand, 17080721 - 17080653
Alignment:
| Q |
8 |
ggatatttgttttggttacattaaactgttaaatttataacaacataatattactattttttggtttaa |
76 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
17080721 |
ggatattttttttggttacattaaactgttaaatttagaacaacataatattactaatttttggtttaa |
17080653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University