View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3321_high_11 (Length: 226)
Name: NF3321_high_11
Description: NF3321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3321_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 3 - 208
Target Start/End: Complemental strand, 36403017 - 36402812
Alignment:
| Q |
3 |
ttgaggaggagcagagaagatgatcatatgatggaagaaaccaatcctttggcgattgtggtagataacagcccttttgatcctattccatctcctacta |
102 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36403017 |
ttgaggaggattagagaagatgatcatatgatggaagaaaccaatcctttggcgattgtggtagataacagcccttttgatcctattccatctcctacta |
36402918 |
T |
 |
| Q |
103 |
gcagaagaaatatggctggtggaagtgcacgtgcaagtggtcaaggtggtagtgaagaacatgtgtcggtggatagggtgaagaaggaggaagttgatgc |
202 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36402917 |
gcagaagaaatatggctagtggaagttcacgtgcaagtggtcaaggtggtagtgaagaacatgtgtcggtggatagggtgaagaaggaggaagttgatgc |
36402818 |
T |
 |
| Q |
203 |
aaagat |
208 |
Q |
| |
|
|||||| |
|
|
| T |
36402817 |
aaagat |
36402812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University