View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3321_low_6 (Length: 315)
Name: NF3321_low_6
Description: NF3321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3321_low_6 |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0027 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 7 - 304
Target Start/End: Original strand, 123276 - 123573
Alignment:
| Q |
7 |
tctatgccaccctcctctttgttcttccttctcaacacttttctcacaaatgatacatagaactctatcctcatcaacttcaactcgaacatcgcttcgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123276 |
tctatgccaccctcctctttgttcttccttctcaacacttttctcacaaatgatacatagaactctatcctcatcaacttcaactcgaacatcgcttcgt |
123375 |
T |
 |
| Q |
107 |
ttcagccccggaaggtgtgctttgtagatatgagcttcatgggtttctttccactctatttgagtgttaataattggtgatggttcgttgtggaaaggtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123376 |
ttcagccccggaaggtgtgctttgtagatatgagcttcatgggtttctttccactctatttgagtgttaataattggtgatggttcgttgtggaaaggtg |
123475 |
T |
 |
| Q |
207 |
gtggtgttatatgatggggtgtgttggtttgagaaatttcataaccatggttttggtatgatgggtggtgccatgtttggtgatgatcttttggttct |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123476 |
gtggtgttatatgatggggtgtgttggtttgagaaattccataaccatggttttggtatgatgggtggtgccatgtttggtgatgatcttttggttct |
123573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University