View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3324_high_4 (Length: 321)
Name: NF3324_high_4
Description: NF3324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3324_high_4 |
 |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0053 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 9937 - 10240
Alignment:
| Q |
1 |
atgtctaaccttttgtcgagtcttctgcatgtatgtctaaacaaccttgcacaaaattctatcatcttttctattgcaataaagtttcggcaatcttttc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9937 |
atgtctaaccctttgtcgagtcttctgcatgtatgtctaaacaaccttgcacaaaattctatcatcttttctattgcaataaagtttcggcaatcttttc |
10036 |
T |
 |
| Q |
101 |
ttgagtaatctctcgtctatcataatattctcatctttgctatggtagcatacttctaattttagccctttaccgtccaacatttatttcataattccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10037 |
ttgagtaatctctcgtctatcataatattctcatctttgctatggtagcatacttctaattttagccctttaccgtccaacatttatttcataattccat |
10136 |
T |
 |
| Q |
201 |
gttttatacttgtgtggtataattttcctttaagaagcagtannnnnnnccttgaatcctaaagcttatatcatcatatatctccacgtcattttatttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10137 |
gttttatacttgtgtggtataattttccgttaagaagtagtatttttttccttgaatcctaaagcttatatcatcatatatctccacgtcattttatttg |
10236 |
T |
 |
| Q |
301 |
atgg |
304 |
Q |
| |
|
|||| |
|
|
| T |
10237 |
atgg |
10240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University