View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3325_low_2 (Length: 481)

Name: NF3325_low_2
Description: NF3325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3325_low_2
NF3325_low_2
[»] chr2 (3 HSPs)
chr2 (150-305)||(4702696-4702852)
chr2 (150-308)||(4706069-4706222)
chr2 (333-385)||(4706506-4706558)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 5e-51; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 150 - 305
Target Start/End: Original strand, 4702696 - 4702852
Alignment:
150 atttgcattgtttagtgaaaca--gtggaatagcaagatgtcagaggctgattctgccatatgcaaaaagaaaaggaaatctgagtggtcaagtatgcct 247  Q
    ||||||||||||||||| ||||  | ||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||| |||||||    
4702696 atttgcattgtttagtgcaacaaagcggaatagcaagatgtcagaggctgattctgccatatgcaaaaagaaaaggaatggagagtggtcaaatatgcct 4702795  T
248 tatgatctgctctcaaatattgcaaatatgctagaactgattgatttttaccagtttt 305  Q
    |||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||    
4702796 tatgatctgctctcaaatattgcaaataggctggaactgattga-ttttaccagtttt 4702852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 150 - 308
Target Start/End: Original strand, 4706069 - 4706222
Alignment:
150 atttgcattgtttagtgaaaca--gtggaatagcaagatgtcagaggctgattctgccatatgcaaaaagaaaaggaaatctgagtggtcaagtatgcct 247  Q
    |||| ||||||||||| |||||  |||||||| ||||||||| |||| |||||||||||| ||||||| ||||  |||    ||||||||| || |  ||    
4706069 atttacattgtttagttaaacaaagtggaataccaagatgtcggaggttgattctgccatctgcaaaatgaaa--gaa----gagtggtcatgtgtaact 4706162  T
248 tatgatctgctctcaaatattgcaaatatgctagaactgattgatttttaccagttttcat 308  Q
    ||||||||||| |||||||||||||||| ||| ||||||||||| ||||||| ||||||||    
4706163 tatgatctgctgtcaaatattgcaaataggctggaactgattga-ttttacctgttttcat 4706222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 333 - 385
Target Start/End: Original strand, 4706506 - 4706558
Alignment:
333 atgactgtattgcagcattttcatctgctcctacatctcaggattgcattgtt 385  Q
    |||||| |||||||||| ||||||||||||| |||||||||||||| ||||||    
4706506 atgactatattgcagcaatttcatctgctcccacatctcaggattgtattgtt 4706558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University