View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3326_high_4 (Length: 382)
Name: NF3326_high_4
Description: NF3326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3326_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 89 - 373
Target Start/End: Original strand, 32503442 - 32503726
Alignment:
| Q |
89 |
cttctccaagcctgtaaagaggaatccaaggtccacttccaccgaaacgagtgacggcttccttaaccgattcgaacggcggcgatgtatcaatctcagc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32503442 |
cttctccaagcctgtaaagaggaatccaaggtccacttccaccgaaacgagtgacggcttccttaaccgattcgaacggcggcgatgtatcaatctcagc |
32503541 |
T |
|
| Q |
189 |
tcgataattgaccttcctaattccgctctccgtatcggcgccggcaacgcgagtttccgccatttccatcgaaagttcgtagaaacgcaagcgcgtattt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32503542 |
tcgataattgaccttcctaattccgctctccgtatcggcgccggcaacgcgagtttccgccatttccatcgaaagttcgtagaaaagcaagcgcgtattt |
32503641 |
T |
|
| Q |
289 |
cagagaagcatcgaaatgagtgatgaagattggagtctcgagaaagatccattggtggaatttatgcaagcgtgatgatgatgtc |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32503642 |
cagagaagcatcgaaatgagtgatgaagattggagtctcgagaaagatccattggtggaatttatgcaagcgtgatgatgatgtc |
32503726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 89 - 155
Target Start/End: Complemental strand, 36248353 - 36248287
Alignment:
| Q |
89 |
cttctccaagcctgtaaagaggaatccaaggtccacttccaccgaaacgagtgacggcttccttaac |
155 |
Q |
| |
|
|||| |||||| |||||||||| | |||||| ||||||||||| |||||||| || ||||||||||| |
|
|
| T |
36248353 |
cttcaccaagcttgtaaagaggtaaccaaggaccacttccaccaaaacgagtaacagcttccttaac |
36248287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University