View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3326_high_7 (Length: 322)
Name: NF3326_high_7
Description: NF3326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3326_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 32503178 - 32502935
Alignment:
| Q |
1 |
tgtgatgatctagttggattagtttctagcttttggaagcctctcaactcaactgccataagtatttagtttttaacttgaggaaaagcccttataaggt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32503178 |
tgtgatgatctagttggattagtctctagcttttggaagcctctcaactcaactgccataagtatttagtttttaactcgaggaaaagcccttataaggt |
32503079 |
T |
 |
| Q |
101 |
tatatgtatttatagagaagttaaaaagggagcctttaaaatgtttaggcatagtggtttatttgcatttatacgagaagccataatttagaagactcca |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32503078 |
tatatgtatttatacagaagttaaaaagggagcctttaaaatgtttaggcatagtggtttatttgcatttatacgagaagccataatttagaagactcga |
32502979 |
T |
 |
| Q |
201 |
agtcattgcagataagtaaagaccatttcaatttttcttttcat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32502978 |
agtcattgcagataagtaaagaccatttcaatttttcttttcat |
32502935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 138 - 184
Target Start/End: Complemental strand, 59337 - 59291
Alignment:
| Q |
138 |
aaaatgtttaggcatagtggtttatttgcatttatacgagaagccat |
184 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||| |||| |
|
|
| T |
59337 |
aaaatgtttaggcatagtgccttatttgcatttatatgagaaaccat |
59291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University