View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3326_low_12 (Length: 232)
Name: NF3326_low_12
Description: NF3326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3326_low_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 33141287 - 33141063
Alignment:
| Q |
1 |
atgttattttctcaaattattattattgtcgacgtatatgtgtagcatgacacatgtgatcacattgaattacattattttcacaacttattatcagatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33141287 |
atgttattttctcaaattattattattgtcgacgtatatgtgtagcatgacacatgtgatcacattgaattacattattttcacaacttattaccagatc |
33141188 |
T |
 |
| Q |
101 |
acattgaattacgttatttcacaacttattatcagtgtcgacgtgtcaatgtccgtttcagtgcatgacacatgtcatcacattgaatatgttagtttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33141187 |
acattgaattacgttatttcacaacttattatcagtgtcgacgtgtcaatgtccgtttcagtgcatgacacatgtcatcacattgaatatgttagtttct |
33141088 |
T |
 |
| Q |
201 |
caaattattatcagtgtcgacgtgt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33141087 |
caaattattatcagtgtcgacgtgt |
33141063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 100 - 188
Target Start/End: Complemental strand, 33135448 - 33135359
Alignment:
| Q |
100 |
cacattgaattacgttattt-cacaacttattatcagtgtcgacgtgtcaatgtccgtttcagtgcatgacacatgtcatcacattgaat |
188 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||||||| |||||| ||||| ||||| | ||| |||||||| ||||| |||||||||||| |
|
|
| T |
33135448 |
cacattgaattgtgttattttcacaaattattatcagagtcgacatgtcagtgtccctgtcactgcatgacccatgtgatcacattgaat |
33135359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 223
Target Start/End: Complemental strand, 33135243 - 33135173
Alignment:
| Q |
153 |
ccgtttcagtgcatgacacatgtcatcacattgaa-tatgttagtttatcaaattattatcagtgtcgacgt |
223 |
Q |
| |
|
|||| |||||||||||||||| | ||||||||||| ||||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
33135243 |
ccgtgtcagtgcatgacacatatgatcacattgaattatgtta-tttctcaaatcattatcagtgtcgacgt |
33135173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 97
Target Start/End: Complemental strand, 33135297 - 33135249
Alignment:
| Q |
49 |
gacacatgtgatcacattgaattacattattttcacaacttattatcag |
97 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
33135297 |
gacaaatgtgatcacattgaattatgttattttcacaaattattatcag |
33135249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 226
Target Start/End: Original strand, 10760849 - 10760908
Alignment:
| Q |
167 |
gacacatgtcatcacattgaatatgttagtttatcaaattattatcagtgtcgacgtgtc |
226 |
Q |
| |
|
||||| ||| || ||||| ||||||| | ||| ||||||||||||||||||||||||||| |
|
|
| T |
10760849 |
gacacgtgtgattacattcaatatgtcattttctcaaattattatcagtgtcgacgtgtc |
10760908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 97 - 144
Target Start/End: Complemental strand, 33135220 - 33135173
Alignment:
| Q |
97 |
gatcacattgaattacgttatttcacaacttattatcagtgtcgacgt |
144 |
Q |
| |
|
||||||||||||||| |||||||| ||| | ||||||||||||||||| |
|
|
| T |
33135220 |
gatcacattgaattatgttatttctcaaatcattatcagtgtcgacgt |
33135173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 37
Target Start/End: Original strand, 10285178 - 10285211
Alignment:
| Q |
4 |
ttattttctcaaattattattattgtcgacgtat |
37 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
10285178 |
ttattttctcaaagtattattattgtcgacgtat |
10285211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 98
Target Start/End: Complemental strand, 33135459 - 33135411
Alignment:
| Q |
50 |
acacatgtgatcacattgaattacattattttcacaacttattatcaga |
98 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33135459 |
acacatgtgaacacattgaattgtgttattttcacaaattattatcaga |
33135411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 19613643 - 19613683
Alignment:
| Q |
1 |
atgttattttctcaaattattattattgtcgacgtatatgt |
41 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
19613643 |
atgttattttctcaaattattatgagtgtcgacgtatatgt |
19613683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 223
Target Start/End: Original strand, 19613621 - 19613677
Alignment:
| Q |
168 |
acacatgtcatcacattgaat-atgttagtttatcaaattattatcagtgtcgacgt |
223 |
Q |
| |
|
|||||| |||| ||||||||| |||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
19613621 |
acacatatcattacattgaattatgttattttctcaaattattatgagtgtcgacgt |
19613677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 5654611 - 5654664
Alignment:
| Q |
180 |
acattgaat-atgttagtttatcaaattattatcagtgtcgacgtgtctgtgct |
232 |
Q |
| |
|
||||||||| |||| | ||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
5654611 |
acattgaattatgtcattttctcaaattattatcagtgtcgacatgtctgtgct |
5654664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University