View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3326_low_9 (Length: 254)
Name: NF3326_low_9
Description: NF3326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3326_low_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 254
Target Start/End: Original strand, 21445148 - 21445386
Alignment:
| Q |
4 |
ttgaggagcagcagagaggattggatcagctgaactatgctttcctaatgcaggaatactaagagaacgttttcttaatttggctctaccatttgatgat |
103 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445148 |
ttgaggagcaccagaaaggattggatcagctgaactatgctttcctaatgcaggaatactaagagaacgttttcttaatttggctctaccatttgatgat |
21445247 |
T |
|
| Q |
104 |
agtttcttctcactcttttcagcaagtaacgaaggataagcgcaaaagggttcttgagatgccactgctattggcaccgctattggcaccggctcacttc |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21445248 |
agtttcttctcactcttttctgcaagtaacgaaggataagcgcaaaagggttcttgagatgccact------------gctattggcaccggctcacttc |
21445335 |
T |
|
| Q |
204 |
tagttctaaggaattggtcgagattttggcggtatttaatcccatggattt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445336 |
tagttctaaggaattggtcgagattttggcggtatttaatcccatggattt |
21445386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University