View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_high_31 (Length: 283)
Name: NF3327_high_31
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 66 - 264
Target Start/End: Complemental strand, 52490684 - 52490486
Alignment:
| Q |
66 |
gaagtatgatgtgaggtgaagcatccatatccatatatgaatgaaggaaatatatgatacagaacattcatactatcaattttacattatatattgcctt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52490684 |
gaagtatgatgtgaggtgaagcatccatatccatatatgaatgaaggaaatatatgatacagaacattcatactatcaattttacattatatattgcctt |
52490585 |
T |
 |
| Q |
166 |
tgacaacatggctaatttttgcattaattttgtcttttgccgacaccctttcttgtctgctacatgtaattgatgattgattgacccaacctatgtact |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52490584 |
tgacaacatggctaatttttgcattaattttgtcttttgccgacaccctttcttgtctgctacatgtaattgatgattgattgacccaacctatgtact |
52490486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 52490749 - 52490709
Alignment:
| Q |
1 |
ggtggcaagtgacaaagaggtccagaatcaaaactcataga |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52490749 |
ggtggcaagtgacaaagaggtccagaatcaaaactcataga |
52490709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University