View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_high_40 (Length: 254)
Name: NF3327_high_40
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_high_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 43870567 - 43870346
Alignment:
| Q |
18 |
atatttgacttgacaattgtagtaacatactagc-tgtcttttagccttgtattgtatggtttcatgaaaccatagagctgaattgacaagatattttta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43870567 |
atatttgacttgacaattgtagtaacatactagcatgtcttttagccttgtattgtatggttttatgaaaccatagagctgaattgac-agatattttta |
43870469 |
T |
|
| Q |
117 |
accttgttatcggtgtgaagtattttctaacttt---atcggtgacttattcttactatattgatgactaattttcatcgagaatttatataaccatctt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | | |||||||||||||| ||||| |||||||||||||| |||| |||||||||| ||| |
|
|
| T |
43870468 |
accttgttatcggtgtgaagtattttctaactttaccagcagtgacttattcttattatatcgatgactaattttcgtcga----ctatataaccacctt |
43870373 |
T |
|
| Q |
214 |
taatgatgtctctcgttttaagcacaa |
240 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
43870372 |
taatgaggtctctcgttttaagcacaa |
43870346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University