View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3327_high_52 (Length: 242)

Name: NF3327_high_52
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3327_high_52
NF3327_high_52
[»] chr6 (1 HSPs)
chr6 (26-71)||(13417331-13417376)


Alignment Details
Target: chr6 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 26 - 71
Target Start/End: Complemental strand, 13417376 - 13417331
Alignment:
26 aaccatgcaatgtgactgcaatgagtaacacttaaaaaagttacac 71  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||    
13417376 aaccatgcaatgtgattgcaatgagtaacacttaaaaaagttacac 13417331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University