View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_high_59 (Length: 227)
Name: NF3327_high_59
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_high_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 37110568 - 37110781
Alignment:
| Q |
1 |
atattcctaattgtaggttccaaattaattaattttatgataatgagggctaattgtagcacgagaatgttaagtaacaatcattatggttgaattttcc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37110568 |
atattcctaattgtaggttctaaatta-ttaattttatgataatgagggctaattgtagcacgagaatgttaagtaacaatcattatggttgaattttcc |
37110666 |
T |
 |
| Q |
101 |
tttccacgtacctaatgatgagtattacaattcttatcttttgnnnnnnnnactatttatagcttgcttacatttctaagtaatgaattacccaatgaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37110667 |
tttccacgtacctaatgatgagtattacaattcttatcttttg-attttttactatttatagcttgcttacatttctaagtaatgaattacccaatgaaa |
37110765 |
T |
 |
| Q |
201 |
actttaacttcaagca |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37110766 |
actttaacttcaagca |
37110781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University