View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_high_62 (Length: 218)
Name: NF3327_high_62
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_high_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 51028628 - 51028441
Alignment:
| Q |
16 |
cagagaacaaaaaactacaaagaaatcaagttctgaactcttaaacaacaagaacaaaacacaagctccaaacccatatctctttaacccaaattcacaa |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51028628 |
cagaaaacaaaaaactacaaagaaatcaaattttgaaatcttaaacaacaagaacaaaacacaagctccaaacccatatctctttaacccaaattcacaa |
51028529 |
T |
 |
| Q |
116 |
tctgatgcaaatataaaatgttaggggttttcaaaacaaaacaccatcaaatctgatgcgaatttaaatggttaaattatgaattttg |
203 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51028528 |
tctggtgcaaatataaaatgttaggggttttcaaaacaaaccaccatcaaatctgatgcgaatttaaatggttaaattatgaattttg |
51028441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University