View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_high_63 (Length: 208)
Name: NF3327_high_63
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_high_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 36 - 192
Target Start/End: Original strand, 42753966 - 42754122
Alignment:
| Q |
36 |
ggcactaagcaaaagaggaaatagaatattcacataccccactaaaattgccttctcagcttttaataaatcaaagaaatgcaaggtagcaagcactgaa |
135 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42753966 |
ggcactaagcaaaacaggaaatagaatattcacataccccactaaaattgccttctcagcttttaataaatcaaagaaatgcaaggtagcaagcactgaa |
42754065 |
T |
 |
| Q |
136 |
aatgccatggagtatgcatttagaggttttgtgtctccatttccagaagttaagttt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42754066 |
aatgccatggagtatgcatttagaggttttgtgtctccatttccagaagttaagttt |
42754122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University