View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_11 (Length: 456)
Name: NF3327_low_11
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 1 - 441
Target Start/End: Original strand, 36374009 - 36374449
Alignment:
| Q |
1 |
aatcacagtcttcctttaacaccgaggtcgagattggaaaggcttttgagagaaagagagctaaggaaatcgagccggtatactcaatcggccgaggacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36374009 |
aatcacagtcttcctttaacaccgaggtcgagattggaaaggcttttgagagaaagagaactaaggaaatcgagccggtatactcaatcggccgaggacg |
36374108 |
T |
|
| Q |
101 |
gaagagatggtggcaaagagggagagcaactttacagtgattcattcataaatgagaatgataatgaggaagaggtagcggaaacgttgtttgcggatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36374109 |
gaagagatggtggcaaagagggagagcaactttacagtgattcattcataaatgagaatgacaatgaggaagaggtcgcggaaacgttgtttgcggatga |
36374208 |
T |
|
| Q |
201 |
taggcctcgcaaacaacgtttgttggtggtagctaacaggttgcctgtctctgctgttagggagggtgtggaatcgtatcaccttgagatcagtgttggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36374209 |
taggcctcgcaaacaacgtttgttggtggtagctaacaggttgcctgtctctgctgttagggagggtgtggaatcgtatcaccttgagatcagtgttggt |
36374308 |
T |
|
| Q |
301 |
ggtcttgtcagtgcacttttaggcaagaaaaaagtttgtcaccttgcattaaattggttttattcttttggctaatttgttttttatccatatcatgtct |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36374309 |
ggtcttgtcagtgcacttttaggcaagaaaaaagtttgtcaccttgcattaaattggttttattcttttggctaatttgttttttatccatatcatgtct |
36374408 |
T |
|
| Q |
401 |
attgtatgtaattcaggtatgtgatttattttctaattatc |
441 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
36374409 |
attgtatgtaattcaggtatgttatttattatctaattatc |
36374449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University