View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_16 (Length: 385)
Name: NF3327_low_16
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 2e-62; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 4 - 145
Target Start/End: Complemental strand, 19065802 - 19065661
Alignment:
| Q |
4 |
aaagaaattattaaacattataatcactttttagtaatcattgtgtaaaaaaccttcttaccgctttttgtaaacatgtcccaattgaaccctaaatgtc |
103 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19065802 |
aaagaaattattaaacattataagcaccttttagtaatcattgtgtaaaaaaccttcttacctctttatgtaaacatgtcccaattgaaccctaaatgtc |
19065703 |
T |
 |
| Q |
104 |
tcaatatatgttgatgacctattatcctcacaataagccaaa |
145 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19065702 |
tcaatatatgttgatggcctattatcctcacaataagccaaa |
19065661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 279 - 343
Target Start/End: Complemental strand, 19065570 - 19065506
Alignment:
| Q |
279 |
atctactcttagttgatcaaggatgaaaacaaagtattttgtctttgtattttcgtgtgcactga |
343 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19065570 |
atctactcttaattgatcaaggatgaaaacaaagtattttgtctttgtattttcgtgtgcactga |
19065506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 259
Target Start/End: Complemental strand, 19065607 - 19065560
Alignment:
| Q |
212 |
tataaatagctattgattgtatttatagttagttacaatctactctta |
259 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19065607 |
tatatatagctattgattgtgtttatagttagttacaatctactctta |
19065560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 287 - 317
Target Start/End: Original strand, 36253202 - 36253232
Alignment:
| Q |
287 |
ttagttgatcaaggatgaaaacaaagtattt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36253202 |
ttagttgatcaaggatgaaaacaaagtattt |
36253232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University