View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_17 (Length: 375)
Name: NF3327_low_17
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 2e-56; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 18 - 140
Target Start/End: Complemental strand, 30019496 - 30019373
Alignment:
| Q |
18 |
atcagaaataagactagttcaacacttatattgtacttcttttcagttaaagaattacatt-cacttgcttggatgtgtttttctctttgcaaagaacat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30019496 |
atcagaaataagactagttcaacacttatattgtacttcttttcagttgaagaattacatttcacttgcttggatgtgtttttctctttgcaaagaacat |
30019397 |
T |
|
| Q |
117 |
gacaacctttgaaggaaacaatga |
140 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30019396 |
gacaacctttgaaggaaacaatga |
30019373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 259 - 363
Target Start/End: Complemental strand, 30019254 - 30019156
Alignment:
| Q |
259 |
tctacaggagattttccctttgaggagtttggtgaatcatttacattcacagttgcagcagctgcagcagtattaacctcattagcttttctttgttctt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| | ||||||||||||||||||||| |
|
|
| T |
30019254 |
tctacaggagattttccctttgaggagtttggtgaatcatttacattcacagttgcagcagcagctgcag------cagcattagcttttctttgttctt |
30019161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 203
Target Start/End: Complemental strand, 30019349 - 30019310
Alignment:
| Q |
164 |
catctgaagctggtccagcttcaacattattattattatc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30019349 |
catctgaagctggtccagcttcaacattattattattatc |
30019310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University