View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_20 (Length: 367)
Name: NF3327_low_20
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 19 - 136
Target Start/End: Original strand, 32006904 - 32007021
Alignment:
| Q |
19 |
ataaagaaagcactatatttttcttaattacactcaatttcttcatcttgcttatgttgttcaattatagcatctcttggttcctatcaaattctcttaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32006904 |
ataaagaaagcactatatttttcttaattacactcaatttcttcatcttgcttatgttgttcaattatagcatctcttggttcctatcaaattctcttaa |
32007003 |
T |
 |
| Q |
119 |
tcttactctctcttcatt |
136 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
32007004 |
tcttaatctctcttcatt |
32007021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 214 - 341
Target Start/End: Original strand, 32007265 - 32007392
Alignment:
| Q |
214 |
ttatggttttcctcttaagtttgtacttcattcaagtatacgtgcttgagttgattttggagagtgttttcagtctttgtgttgcctactagaggttctc |
313 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32007265 |
ttatggttttcctcttaagtgtgtacttcattcaagtatacctgcttgagttgattttggagagtgttttcagtctttgtgttgcctactagaggttctc |
32007364 |
T |
 |
| Q |
314 |
ctacttgttttatttttcctagtcgttg |
341 |
Q |
| |
|
|||||||||||||||||| |||| |||| |
|
|
| T |
32007365 |
ctacttgttttatttttcatagtggttg |
32007392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 171 - 219
Target Start/End: Original strand, 32007074 - 32007122
Alignment:
| Q |
171 |
ataccaccgttattgatcaattggtaaatatgactaatttctcttatgg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32007074 |
ataccaccgttattgatcaattggtaaatatgactaatttctcttatgg |
32007122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University