View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_29 (Length: 293)
Name: NF3327_low_29
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 30013715 - 30013426
Alignment:
| Q |
1 |
acatggatattcttcaatttatatataaaaatttaaaaatgtctctaagcacatataggtatgaagaaatttgataggattacatacaaattttaatatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30013715 |
acatggatattcttcaatttatatatataaatttaaaaatgtctctaagcacatatagatatgaagaaatttgataggataacatacaaattttaatatc |
30013616 |
T |
 |
| Q |
101 |
aattataagttgaaccaacctttatgttattttcgtaacaaaaatgaactttgttatttcatttattgtatgtgactgttatggttgtaaagctagtact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30013615 |
aattataagttgaaccaacctttatgttatttttgtaacaaaaaagaactttgttatttcatttattgtatgtgactgttatggttgtaaagcaagtact |
30013516 |
T |
 |
| Q |
201 |
agtactaccacatacaataacttgatagtgcccccttgcttaatctataatttaatatgtcaccgtgcatataattttgatgatgtccat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30013515 |
agtactaccacatacaataacttgatagtgcccccttgcttaatctataatttaatatgtcaccgtgcatataattttgatgatgaccat |
30013426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University