View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_37 (Length: 259)
Name: NF3327_low_37
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 252
Target Start/End: Complemental strand, 26777173 - 26776941
Alignment:
| Q |
20 |
cagcataagctccaactccagaaggcggggttgcaacatacattccggcacgtggagctggtggatcatttaaagttctggtaccagcagatggagcttg |
119 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26777173 |
cagcataaactccgactccagaaggcggggtcacaacatacattccggcaggtggaactggtggatcatttaaagttctggtaccagcagatggagcttg |
26777074 |
T |
 |
| Q |
120 |
aggagtttgtgtggctgattttctggcagaatcgcttgcttgatcggtaattgctccatgaggtgctgaaatgtctccattttcgacatatgtgacatca |
219 |
Q |
| |
|
|||||||||||||||||||| ||| ||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26777073 |
aggagtttgtgtggctgattgtcttgcataatcacttgcttgaccggtaattgctccatgaggtgctgaaatgtctccattttcgacatatgtgacatca |
26776974 |
T |
 |
| Q |
220 |
tgtctgctggatcgccttctttctttcttctct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26776973 |
tgtctgctggatcgccttctttctttcttctct |
26776941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 145 - 252
Target Start/End: Original strand, 26553800 - 26553907
Alignment:
| Q |
145 |
gcagaatcgcttgcttgatcggtaattgctccatgaggtgctgaaatgtctccattttcgacatatgtgacatcatgtctgctggatcgccttctttctt |
244 |
Q |
| |
|
||||||| |||||||||| ||||||||| ||| ||||||||||||||||||||||||| |||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
26553800 |
gcagaattgcttgcttgaccggtaattggtccttgaggtgctgaaatgtctccatttttgacaaaggtgacatcatgtatgctggatcgccttctttctt |
26553899 |
T |
 |
| Q |
245 |
tcttctct |
252 |
Q |
| |
|
|||||||| |
|
|
| T |
26553900 |
tcttctct |
26553907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University