View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3327_low_48 (Length: 249)

Name: NF3327_low_48
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3327_low_48
NF3327_low_48
[»] chr2 (2 HSPs)
chr2 (31-229)||(43583760-43583958)
chr2 (32-71)||(9752255-9752294)
[»] chr3 (1 HSPs)
chr3 (31-71)||(12783604-12783644)


Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 31 - 229
Target Start/End: Complemental strand, 43583958 - 43583760
Alignment:
31 gatatatcagccatactctaatcttgtgtctagtgctcataaacctggtgacaagatttgccaacaactggaattccacgtgagttacttgtggaattca 130  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||||||||||    
43583958 gatatatcagccatactctaatcttgtgtctagtgctcataaacctggtgacaagatttgccaacaactggatttccatttgagttacttgtggaattca 43583859  T
131 aaatgagtgaacagaaactcatgaatcatgggtcataatacatcacatattggttgtttttgttgaggtctatttatactaaggcaacatgtgatatgg 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
43583858 aaatgagtgaacagaaactcatgaatcatgggtcataatacatcacatattggttgtttttgttgaggtctatctatactaaggcaacatgtgatatgg 43583760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 71
Target Start/End: Original strand, 9752255 - 9752294
Alignment:
32 atatatcagccatactctaatcttgtgtctagtgctcata 71  Q
    |||||||||| |||||||||||||||||||||||||||||    
9752255 atatatcagctatactctaatcttgtgtctagtgctcata 9752294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 31 - 71
Target Start/End: Original strand, 12783604 - 12783644
Alignment:
31 gatatatcagccatactctaatcttgtgtctagtgctcata 71  Q
    ||||||||||| |||||||||||||||||||||||||||||    
12783604 gatatatcagctatactctaatcttgtgtctagtgctcata 12783644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University