View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_48 (Length: 249)
Name: NF3327_low_48
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 31 - 229
Target Start/End: Complemental strand, 43583958 - 43583760
Alignment:
| Q |
31 |
gatatatcagccatactctaatcttgtgtctagtgctcataaacctggtgacaagatttgccaacaactggaattccacgtgagttacttgtggaattca |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
43583958 |
gatatatcagccatactctaatcttgtgtctagtgctcataaacctggtgacaagatttgccaacaactggatttccatttgagttacttgtggaattca |
43583859 |
T |
|
| Q |
131 |
aaatgagtgaacagaaactcatgaatcatgggtcataatacatcacatattggttgtttttgttgaggtctatttatactaaggcaacatgtgatatgg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43583858 |
aaatgagtgaacagaaactcatgaatcatgggtcataatacatcacatattggttgtttttgttgaggtctatctatactaaggcaacatgtgatatgg |
43583760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 71
Target Start/End: Original strand, 9752255 - 9752294
Alignment:
| Q |
32 |
atatatcagccatactctaatcttgtgtctagtgctcata |
71 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9752255 |
atatatcagctatactctaatcttgtgtctagtgctcata |
9752294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 31 - 71
Target Start/End: Original strand, 12783604 - 12783644
Alignment:
| Q |
31 |
gatatatcagccatactctaatcttgtgtctagtgctcata |
71 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12783604 |
gatatatcagctatactctaatcttgtgtctagtgctcata |
12783644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University