View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_54 (Length: 242)
Name: NF3327_low_54
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 26 - 71
Target Start/End: Complemental strand, 13417376 - 13417331
Alignment:
| Q |
26 |
aaccatgcaatgtgactgcaatgagtaacacttaaaaaagttacac |
71 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13417376 |
aaccatgcaatgtgattgcaatgagtaacacttaaaaaagttacac |
13417331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University