View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_59 (Length: 237)
Name: NF3327_low_59
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_59 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 37111210 - 37110990
Alignment:
| Q |
17 |
gtttccaccttgatctaataaaagagatgcatcacatccctgcaatacacaaattaaggacattagttattaatcaatcacctaaattctggctcattaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111210 |
gtttccaccttgatctaataaaagagatgcatcacatccctgcaatacacaaattaaggacattagttattaatcaatcacctaaattctggctcattaa |
37111111 |
T |
|
| Q |
117 |
tcaaaatgtataagaaattacattaacaaagcaatcgtgaaagtgaagacgggttaggcttgcggtaatacgaggatcattttgcagagcttgttgaaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111110 |
tcaaaatgtataagaaattacattaacaaagcaatcgtgaaagtgaagacgggttaggctcgcggtaatacgaggatcattttgcagagcttgttgaaca |
37111011 |
T |
|
| Q |
217 |
acatttcttactatagaagaa |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37111010 |
acatttcttactatagaagaa |
37110990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University