View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_63 (Length: 222)
Name: NF3327_low_63
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 411508 - 411695
Alignment:
| Q |
15 |
cagagactggtcagataagcattgatggaaaagtgaagtacggtacaccacaccttacatgtgtgggatcttttgctgtggatgtgagcttagaagggaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
411508 |
cagagactggtcagataagcattgatggaaaagtgaagtacggtacaccacaccttacatgtgtgggatcttttgctgtggatgtgagcttagaagggaa |
411607 |
T |
|
| Q |
115 |
tctgattttgtgcagacagattgatcaacctgggatgattggtactgtcggaaacatattaggcgagaaaaatgtgaatgtgagcttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
411608 |
tctgattttgtgcagacagattgatcaacctgggatgattggtactgtcggaaacatattaggcgagaaaaatgtgaatgtgagcttt |
411695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University