View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3327_low_67 (Length: 206)
Name: NF3327_low_67
Description: NF3327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3327_low_67 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 2926252 - 2926428
Alignment:
| Q |
11 |
gaagcaaaggagtgaatgcaaaatagttacgaggcgaaaccacctgtacttcatactttggactgtccagattcttcataaaacttgttgccgcccatcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926252 |
gaagcaaaggagtgaatgcaaaatagttacgaggcgaaaccacctgtacttcatactttggactgtccagattcttcataaaacttgttgccgcccatcc |
2926351 |
T |
 |
| Q |
111 |
tgttcccaacaccaccacttttttcctatcggtaaccgcctccacttccgatggataaaactcgcgatatgccacat |
187 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926352 |
tgttcccagcaccaccacttttttcctatcggtaaccgcctccacttccgatggataaaactcgcgatatgccacat |
2926428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University