View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3328_high_13 (Length: 316)
Name: NF3328_high_13
Description: NF3328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3328_high_13 |
 | |
|
| [»] scaffold0536 (2 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 257
Target Start/End: Complemental strand, 48911466 - 48911227
Alignment:
| Q |
19 |
agttgctatgtcgcatagagggatcatgtggccaggtgctaagtaaggtatgaagtatatattaagtggtttctcttctccttcttccgtattcatcatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48911466 |
agttgctatgtcgcatagagggatcatgtggccaggtgctaagtaaggtatgaagtagatggtaagtgctttctcttctccttcttccgtattcatcatc |
48911367 |
T |
|
| Q |
119 |
tttgccttgtcttctgtgtgtttggatactatatatgaattagaatgaacgtgatgatgagagaggtattgtactaattaattgtttctgctattgcttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
48911366 |
tttgccttgtcttctgtgtgtttggatactatgaatgaattagaatgaacgtgatgatgagagaggtattgtagcaattaactgtttctgctattgcttt |
48911267 |
T |
|
| Q |
219 |
taatgtccaacaatggaga-gatcctaactctggttgccc |
257 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48911266 |
taatgtccaacaatggagaggatcctaactctggttgccc |
48911227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0536 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: scaffold0536
Description:
Target: scaffold0536; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 20 - 115
Target Start/End: Complemental strand, 5631 - 5536
Alignment:
| Q |
20 |
gttgctatgtcgcatagagggatcatgtggccaggtgctaagtaaggtatgaagtatatattaagtggtttctcttctccttcttccgtattcatc |
115 |
Q |
| |
|
||||||||||| |||| ||||||||| || ||||| |||||||||||||||||||| ||| |||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
5631 |
gttgctatgtcacataaagggatcatatgaccaggagctaagtaaggtatgaagtagatagtaagtgctttctcttctccttcttccatatccatc |
5536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0536; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 25 - 98
Target Start/End: Complemental strand, 9626 - 9553
Alignment:
| Q |
25 |
tatgtcgcatagagggatcatgtggccaggtgctaagtaaggtatgaagtatatattaagtggtttctcttctc |
98 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
9626 |
tatgtcgcatagagggatcatatgaccaggtgataagtaaggtatgaagtagattttaagtgctttctcttctc |
9553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 169 - 225
Target Start/End: Original strand, 31742730 - 31742786
Alignment:
| Q |
169 |
gtgatgatgagagaggtattgtactaattaattgtttctgctattgcttttaatgtc |
225 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| |||| ||||||||||||| |||| |
|
|
| T |
31742730 |
gtgatgatgagagagttattgtagcaattaattatttccgctattgcttttagtgtc |
31742786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University