View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3328_low_17 (Length: 315)
Name: NF3328_low_17
Description: NF3328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3328_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 6e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 51 - 133
Target Start/End: Complemental strand, 49767062 - 49766980
Alignment:
| Q |
51 |
catgcaatgcattgatcatccatacagaaacaaccctggtgggatctgtgctttttgtcttcaagaaaaacttggtaaactcg |
133 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49767062 |
catgcaatgcattgatcatccatatagaaacaaccctggtgggatctgtgctttttgtcttcaagaaaaacttggtaaactcg |
49766980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 232 - 311
Target Start/End: Complemental strand, 49766881 - 49766799
Alignment:
| Q |
232 |
actactcgtcattgtccttcttcttcttc---catcaacactgtatcagctacaactgctgtaacttcatcttcttctctctc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49766881 |
actactcgtcattgtccttcttcttcttcttccatcaacactgtatcagcaacaactgctgtaacttcatcttcttctctctc |
49766799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 85 - 131
Target Start/End: Original strand, 14137707 - 14137753
Alignment:
| Q |
85 |
cctggtgggatctgtgctttttgtcttcaagaaaaacttggtaaact |
131 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14137707 |
cctggtggtatatgtgctttttgtcttcaagaaaaacttggtaaact |
14137753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University