View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3328_low_20 (Length: 276)

Name: NF3328_low_20
Description: NF3328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3328_low_20
NF3328_low_20
[»] chr2 (1 HSPs)
chr2 (18-271)||(2017059-2017312)
[»] chr3 (3 HSPs)
chr3 (86-242)||(40566430-40566586)
chr3 (45-234)||(40595769-40595958)
chr3 (68-242)||(40589388-40589562)


Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 271
Target Start/End: Complemental strand, 2017312 - 2017059
Alignment:
18 accaatcattttggggtatcagaatgacacatcttcccgtctcatcaacacgaaacaagttttttgccgttggctgtgacacgattgcaatactcgcagc 117  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
2017312 accaatcattttggggtatcagaatgacacattttcccgtctcatcaacacgaaacaagtttgttgccgttggctgtgacacgattgcaatactcgcagc 2017213  T
118 atttgattttgggggaaacaactacacgacgggatgtttggctttgtgcaacaggtttaatgatatcgtggccaatgaatcttgctccggcactggttgt 217  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2017212 atttgattttgggggaaacaactacaccacgggatgtttggctttgtgcaacaggtttaatgatatcgtggccaatgaatcttgctccggcactggttgt 2017113  T
218 tgtcagatttcaataccgcaaggtcatttgttcgagaaagtgtcctttgctact 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
2017112 tgtcagatttcaataccgcaaggtcatttgttcgagaaagtgtcctttgttact 2017059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 86 - 242
Target Start/End: Original strand, 40566430 - 40566586
Alignment:
86 gttggctgtgacacgattgcaatactcgcagcatttgattttgggggaaacaactacacgacgggatgtttggctttgtgcaacaggtttaatgatatcg 185  Q
    ||||||||||||||||||| |  |||| | ||  |||||| |||||||||||||||||| || |||||| ||||||| ||||||||| || |||||||      
40566430 gttggctgtgacacgattggagcactctcggcgattgattctgggggaaacaactacaccacaggatgtgtggctttatgcaacaggcttgatgatatta 40566529  T
186 tggccaatgaatcttgctccggcactggttgttgtcagatttcaataccgcaaggtc 242  Q
    |||||| | |||||||||| || |||||||||||  ||||||||||||| |||||||    
40566530 tggccagtcaatcttgctcaggtactggttgttgcgagatttcaataccccaaggtc 40566586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 45 - 234
Target Start/End: Original strand, 40595769 - 40595958
Alignment:
45 cacatcttcccgtctcatcaacacgaaacaagttttttgccgttggctgtgacacgattgcaatactcgcagcatttgattttgggggaaacaactacac 144  Q
    ||||| ||| ||||||  |||| | |||||||||  | || ||||| |||||||| || | | |||||| |||| |||||| |   |||||||  |||||    
40595769 cacattttcacgtctcgccaactcaaaacaagttgatagcagttggatgtgacacaatgggactactcgaagcaattgattctaaaggaaacacatacac 40595868  T
145 gacgggatgtttggctttgtgcaacaggtttaatgatatcgtggccaatgaatcttgctccggcactggttgttgtcagatttcaatacc 234  Q
     || | |||| |||| |||||||||||| ||| |||||| ||||||||||||||||| |||||| | ||||||||| |||||||||||||    
40595869 cactgcatgtgtggccttgtgcaacaggcttagtgatattgtggccaatgaatcttgttccggcccaggttgttgtgagatttcaatacc 40595958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 68 - 242
Target Start/End: Original strand, 40589388 - 40589562
Alignment:
68 cgaaacaagttttttgccgttggctgtgacacgattgcaatactcgcagcatttgattttgggggaaacaactacacgacgggatgtttggctttgtgca 167  Q
    |||||||||||  | || ||||||||||| ||   || |||||||| || | |||||| ||  ||||||||||||||  | ||||||||||||| |||||    
40589388 cgaaacaagttggtagcagttggctgtgatacatctggaatactcggagtaattgattctgaaggaaacaactacacctctggatgtttggcttggtgca 40589487  T
168 acaggtttaatgatatcgtggccaatgaatcttgctccggcactggttgttgtcagatttcaataccgcaaggtc 242  Q
    |||||     |||| |||| |||||||| ||||| || ||  |||||||||| ||||||||  |||| |||||||    
40589488 acaggcacgctgatctcgttgccaatgagtcttgttctggtcctggttgttgccagatttcggtaccccaaggtc 40589562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University