View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3328_low_22 (Length: 250)
Name: NF3328_low_22
Description: NF3328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3328_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 32992550 - 32992791
Alignment:
| Q |
1 |
caaaaatctaatcgaatcaattctagttttaaaacattgttttacttggacaccttgaaagctccatgacctatagcaggacagatttggacttgaaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32992550 |
caaaaatctaatcgaatcaattctagttttaaaacattgttttacttggacaccttgaaagctccatgacctatagcaggacagatttggacttgaaagc |
32992649 |
T |
 |
| Q |
101 |
tcaattctcaatttttgttttgggtctaaaattgtacatttgtgtagtggggaccactcatcaatgaagcaaggtcactattgggggcattggcatataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
32992650 |
tcaattctcaatttttgttttgggtctaaaattgtacatttgtgtagtggggaccactcaccaatgaagccaggtcactattgggggcattggcat---a |
32992746 |
T |
 |
| Q |
201 |
taaaactaattaatctaaatcaacttgagttggattttcttcgac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32992747 |
taaaactaattaatctaaatcaacttgagttggattttcttcgac |
32992791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University