View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3328_low_25 (Length: 246)
Name: NF3328_low_25
Description: NF3328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3328_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 32992462 - 32992245
Alignment:
| Q |
1 |
ttgtttcatattatttgtctcttactattatcgatgaaatattaattaannnnnnnactaatatattattatttattatacttcaatttttctaactcgt |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||| |
|
|
| T |
32992462 |
ttgtctcatattatttgtctcttactattatcgatgaaatattaattaat-----------tttactattatttattatacttcaatttttctaactcgt |
32992374 |
T |
 |
| Q |
101 |
tcgtctcataataagtgacatatttgagatgtttataatgaga-cgggagagtaatagataaaaagaagtaaaaagaaaatcacttgaaccaaccgtgga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
32992373 |
tcgtctcataataagtgacatatttgagatgcttataatgagatggggagagtaatagataaaaagaagtacaaagaaaatcgcttgagccaaccgtgga |
32992274 |
T |
 |
| Q |
200 |
taccgattcaaaccaattcaatctggttc |
228 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
32992273 |
tatcgattcaaaccaattcaatctggttc |
32992245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University