View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3328_low_29 (Length: 238)
Name: NF3328_low_29
Description: NF3328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3328_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 37 - 221
Target Start/End: Complemental strand, 3657891 - 3657707
Alignment:
| Q |
37 |
gtatacaataggttatcaactactacnnnnnnntaggttatcaactaatccaagcactttataagtcgatgtgttttctacacttaaaagcaacaacata |
136 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3657891 |
gtatacaataggttatcaactactctaaaaaaataggttatcaactaatccaaacactttataagtcgatgtgttttctacacttaaaagcaacaacata |
3657792 |
T |
 |
| Q |
137 |
ctataccccaacatactatattgccatgttaatataatttttctaacgtgccttcccatatagtgaaagttatgacccttgtaat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3657791 |
ctataccccaacatactatattgccatgttaatataatttttctaacgtgccttcccatatagtgaaagttatgacccttgtaat |
3657707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University