View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3330_high_3 (Length: 283)
Name: NF3330_high_3
Description: NF3330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3330_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 6623345 - 6623088
Alignment:
| Q |
10 |
gcacagattggaaaagggaaatctgccaccgagaggtgaggattcttcattagttatttggatatcttgattatcttcctacatttttgaacctctgaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6623345 |
gcacagattggaaaagggaaatctgccaccgagaggtgaggattcttcattagttacttggatatcttgattatcttcctacattttttaacctctgaat |
6623246 |
T |
 |
| Q |
110 |
ccatgacccatcctgcgtacaacttgaccattatgttctgcataatttttatgcattatccttatctttaagtatatgagaaagtaacttctactttaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6623245 |
ccatgacccatcctgcgtacaacttgaccattatgttctgcataatttttatgcattatccttatctttaagtatatgagaaagtaacttctactttaca |
6623146 |
T |
 |
| Q |
210 |
atccattatccttttcttgaagtatgtaacatagtaacttctacattacagtggcatt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6623145 |
atccattatccttttcttgaagtatgtaacatagtaacttctacattacagtggcatt |
6623088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University