View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3330_high_7 (Length: 248)
Name: NF3330_high_7
Description: NF3330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3330_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 232
Target Start/End: Original strand, 33749950 - 33750163
Alignment:
| Q |
19 |
ataaatccaagtttttaccctttcaaagatcaaaagtgaaccgtgtgggatcggtgtgcacagctggctcnnnnnnnngccatgtcagttccaaatcgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33749950 |
ataaatccaagtttttaccctttcaaagatcaaaagtgaaccgtgtgggatcggtgtgcacagctggctcttttttttgccatgtcagttccaaatcgta |
33750049 |
T |
 |
| Q |
119 |
tataaaccatttccaccctctgactttccaaaaacatcaaatcttctaaaccttaaacattccaaactccaacacaaacaacctgccacttcccaaacat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33750050 |
tataaaccatttccaccctctgactttccaaaaacatcaaatcttctaaaccttaaacattccaaactccaacacaaacaacctgccacttcccaaacat |
33750149 |
T |
 |
| Q |
219 |
gaacatgaactact |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33750150 |
gaacatgaactact |
33750163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University